Review





Similar Products

90
Qiagen mircury lna mirna probe pcr assays
Upregulation of 18 miRNAs in HCC patients (A) Study design of the current study. CQ, Chongqing; BJ, Beijing. (B) Volcano plot of differentially expressed miRNAs between HCC patients and LC patients in the discovery stage. The 16 validated <t>miRNA</t> targets were annotated. (C) Unsupervised hierarchical clustering of 18 miRNA targets across 354 matched samples in validation stage 1.
Mircury Lna Mirna Probe Pcr Assays, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mircury lna mirna probe pcr assays/product/Qiagen
Average 90 stars, based on 1 article reviews
mircury lna mirna probe pcr assays - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Telog Instruments Inc gggttagggttagggttagggttagggttagggtta (tamra) telog lna tm probe
Upregulation of 18 miRNAs in HCC patients (A) Study design of the current study. CQ, Chongqing; BJ, Beijing. (B) Volcano plot of differentially expressed miRNAs between HCC patients and LC patients in the discovery stage. The 16 validated <t>miRNA</t> targets were annotated. (C) Unsupervised hierarchical clustering of 18 miRNA targets across 354 matched samples in validation stage 1.
Gggttagggttagggttagggttagggttagggtta (Tamra) Telog Lna Tm Probe, supplied by Telog Instruments Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gggttagggttagggttagggttagggttagggtta (tamra) telog lna tm probe/product/Telog Instruments Inc
Average 90 stars, based on 1 article reviews
gggttagggttagggttagggttagggttagggtta (tamra) telog lna tm probe - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Qiagen tye563-teloc lna probes
Upregulation of 18 miRNAs in HCC patients (A) Study design of the current study. CQ, Chongqing; BJ, Beijing. (B) Volcano plot of differentially expressed miRNAs between HCC patients and LC patients in the discovery stage. The 16 validated <t>miRNA</t> targets were annotated. (C) Unsupervised hierarchical clustering of 18 miRNA targets across 354 matched samples in validation stage 1.
Tye563 Teloc Lna Probes, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/tye563-teloc lna probes/product/Qiagen
Average 90 stars, based on 1 article reviews
tye563-teloc lna probes - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Telog Instruments Inc lna probe
Upregulation of 18 miRNAs in HCC patients (A) Study design of the current study. CQ, Chongqing; BJ, Beijing. (B) Volcano plot of differentially expressed miRNAs between HCC patients and LC patients in the discovery stage. The 16 validated <t>miRNA</t> targets were annotated. (C) Unsupervised hierarchical clustering of 18 miRNA targets across 354 matched samples in validation stage 1.
Lna Probe, supplied by Telog Instruments Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lna probe/product/Telog Instruments Inc
Average 90 stars, based on 1 article reviews
lna probe - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Fasmac Co Ltd lna probe
Upregulation of 18 miRNAs in HCC patients (A) Study design of the current study. CQ, Chongqing; BJ, Beijing. (B) Volcano plot of differentially expressed miRNAs between HCC patients and LC patients in the discovery stage. The 16 validated <t>miRNA</t> targets were annotated. (C) Unsupervised hierarchical clustering of 18 miRNA targets across 354 matched samples in validation stage 1.
Lna Probe, supplied by Fasmac Co Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lna probe/product/Fasmac Co Ltd
Average 90 stars, based on 1 article reviews
lna probe - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Fasmac Co Ltd lna probe new-24baselna*3
Upregulation of 18 miRNAs in HCC patients (A) Study design of the current study. CQ, Chongqing; BJ, Beijing. (B) Volcano plot of differentially expressed miRNAs between HCC patients and LC patients in the discovery stage. The 16 validated <t>miRNA</t> targets were annotated. (C) Unsupervised hierarchical clustering of 18 miRNA targets across 354 matched samples in validation stage 1.
Lna Probe New 24baselna*3, supplied by Fasmac Co Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lna probe new-24baselna*3/product/Fasmac Co Ltd
Average 90 stars, based on 1 article reviews
lna probe new-24baselna*3 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Qiagen mircury lna mirna detection probes
Upregulation of 18 miRNAs in HCC patients (A) Study design of the current study. CQ, Chongqing; BJ, Beijing. (B) Volcano plot of differentially expressed miRNAs between HCC patients and LC patients in the discovery stage. The 16 validated <t>miRNA</t> targets were annotated. (C) Unsupervised hierarchical clustering of 18 miRNA targets across 354 matched samples in validation stage 1.
Mircury Lna Mirna Detection Probes, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mircury lna mirna detection probes/product/Qiagen
Average 90 stars, based on 1 article reviews
mircury lna mirna detection probes - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

90
Qiagen mircury lna mirna detection probes handbook
Upregulation of 18 miRNAs in HCC patients (A) Study design of the current study. CQ, Chongqing; BJ, Beijing. (B) Volcano plot of differentially expressed miRNAs between HCC patients and LC patients in the discovery stage. The 16 validated <t>miRNA</t> targets were annotated. (C) Unsupervised hierarchical clustering of 18 miRNA targets across 354 matched samples in validation stage 1.
Mircury Lna Mirna Detection Probes Handbook, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mircury lna mirna detection probes handbook/product/Qiagen
Average 90 stars, based on 1 article reviews
mircury lna mirna detection probes handbook - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

Image Search Results


Upregulation of 18 miRNAs in HCC patients (A) Study design of the current study. CQ, Chongqing; BJ, Beijing. (B) Volcano plot of differentially expressed miRNAs between HCC patients and LC patients in the discovery stage. The 16 validated miRNA targets were annotated. (C) Unsupervised hierarchical clustering of 18 miRNA targets across 354 matched samples in validation stage 1.

Journal: iScience

Article Title: Establishing a miRNA panel for hepatocellular carcinoma screening through a multicenter study

doi: 10.1016/j.isci.2025.112986

Figure Lengend Snippet: Upregulation of 18 miRNAs in HCC patients (A) Study design of the current study. CQ, Chongqing; BJ, Beijing. (B) Volcano plot of differentially expressed miRNAs between HCC patients and LC patients in the discovery stage. The 16 validated miRNA targets were annotated. (C) Unsupervised hierarchical clustering of 18 miRNA targets across 354 matched samples in validation stage 1.

Article Snippet: 3 μL of extracted RNA was reverse transcribed using the miRCURY LNA RT Kit (Qiagen) in 10 μL reactions. cDNA was diluted 20× before qPCR. qPCR was performed using miRCURY LNA miRNA Probe PCR Assays (Qiagen).

Techniques: Biomarker Discovery

Forest plot of study-wide significant miRNAs in HCC CI, confidence interval; SMD, standardized mean difference. Upregulation of 4 miRNAs in our findings was validated through a meta-analysis.

Journal: iScience

Article Title: Establishing a miRNA panel for hepatocellular carcinoma screening through a multicenter study

doi: 10.1016/j.isci.2025.112986

Figure Lengend Snippet: Forest plot of study-wide significant miRNAs in HCC CI, confidence interval; SMD, standardized mean difference. Upregulation of 4 miRNAs in our findings was validated through a meta-analysis.

Article Snippet: 3 μL of extracted RNA was reverse transcribed using the miRCURY LNA RT Kit (Qiagen) in 10 μL reactions. cDNA was diluted 20× before qPCR. qPCR was performed using miRCURY LNA miRNA Probe PCR Assays (Qiagen).

Techniques:

Diagnostic performance and risk score of combined panel across different sample sets (A) In the training set. (B) In the testing set. (C) In the validation set. (D) Risk score distribution of combined panel across patients with different HCC stages. The combined panel demonstrated superior diagnostic performance compared to AFP20 alone across all sample sets. miRNA panel: miR-361-5p+ miR-130a-3p+ miR-27a-3p+ miR-30d-5p+ miR-193a-5p. ∗ p < 0.05; ∗∗ p < 0.01; ∗∗∗ p < 10 − 3 ; ∗∗∗∗ p < 10 − 4 .

Journal: iScience

Article Title: Establishing a miRNA panel for hepatocellular carcinoma screening through a multicenter study

doi: 10.1016/j.isci.2025.112986

Figure Lengend Snippet: Diagnostic performance and risk score of combined panel across different sample sets (A) In the training set. (B) In the testing set. (C) In the validation set. (D) Risk score distribution of combined panel across patients with different HCC stages. The combined panel demonstrated superior diagnostic performance compared to AFP20 alone across all sample sets. miRNA panel: miR-361-5p+ miR-130a-3p+ miR-27a-3p+ miR-30d-5p+ miR-193a-5p. ∗ p < 0.05; ∗∗ p < 0.01; ∗∗∗ p < 10 − 3 ; ∗∗∗∗ p < 10 − 4 .

Article Snippet: 3 μL of extracted RNA was reverse transcribed using the miRCURY LNA RT Kit (Qiagen) in 10 μL reactions. cDNA was diluted 20× before qPCR. qPCR was performed using miRCURY LNA miRNA Probe PCR Assays (Qiagen).

Techniques: Diagnostic Assay, Biomarker Discovery

Association of miRNAs with clinical parameters (A–C) Association with (A) different HCC stages, (B) tumor size, and (C) tumor invasion. 3 miRNAs (miR-130a-3p, miR-361-5p, and miR-27a-3p) in the panel demonstrated further upregulation in patients with late-stage HCC and larger tumor size. ns, not significant; ∗P adj < 0.05; ∗∗ P adj < 0.01; ∗∗∗ P adj < 10 −3 ; ∗∗∗∗ P adj < 10 −4 . (D) Interaction network of the 5 miRNAs in the panel and their target genes. Only genes targeted by 3 or more miRNAs are shown. (E) KEGG enrichment analysis for target genes of the 5-miRNA panel.

Journal: iScience

Article Title: Establishing a miRNA panel for hepatocellular carcinoma screening through a multicenter study

doi: 10.1016/j.isci.2025.112986

Figure Lengend Snippet: Association of miRNAs with clinical parameters (A–C) Association with (A) different HCC stages, (B) tumor size, and (C) tumor invasion. 3 miRNAs (miR-130a-3p, miR-361-5p, and miR-27a-3p) in the panel demonstrated further upregulation in patients with late-stage HCC and larger tumor size. ns, not significant; ∗P adj < 0.05; ∗∗ P adj < 0.01; ∗∗∗ P adj < 10 −3 ; ∗∗∗∗ P adj < 10 −4 . (D) Interaction network of the 5 miRNAs in the panel and their target genes. Only genes targeted by 3 or more miRNAs are shown. (E) KEGG enrichment analysis for target genes of the 5-miRNA panel.

Article Snippet: 3 μL of extracted RNA was reverse transcribed using the miRCURY LNA RT Kit (Qiagen) in 10 μL reactions. cDNA was diluted 20× before qPCR. qPCR was performed using miRCURY LNA miRNA Probe PCR Assays (Qiagen).

Techniques: