Review





Similar Products

86
Kaneka Corp dig labeled lna probes
Dig Labeled Lna Probes, supplied by Kaneka Corp, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dig labeled lna probes/product/Kaneka Corp
Average 86 stars, based on 1 article reviews
dig labeled lna probes - by Bioz Stars, 2026-05
86/100 stars
  Buy from Supplier

86
Eurofins lna probe
Lna Probe, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lna probe/product/Eurofins
Average 86 stars, based on 1 article reviews
lna probe - by Bioz Stars, 2026-05
86/100 stars
  Buy from Supplier

93
R&D Systems mir 210 bound digoxigenin labeled lna detection probe
Mir 210 Bound Digoxigenin Labeled Lna Detection Probe, supplied by R&D Systems, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mir 210 bound digoxigenin labeled lna detection probe/product/R&D Systems
Average 93 stars, based on 1 article reviews
mir 210 bound digoxigenin labeled lna detection probe - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

86
Sangon Biotech digoxin labeled lna modified circaass probe
<t>CircAass</t> was downregulated in renal cortex of AKI mice. (A) Cluster heat map representing distinct circRNA expression values in I/R-AKI mice compared with Sham controls. (B) Clustered heat map showing the differentially expressed circRNAs in renal cortex between the CP-AKI mice and Control mice. (C) Cluster heat map showing the differences in the expression of circRNA in SAKI mice and Sham mice. (D) Venn diagram showing the two common differentially expressed circRNAs identified by RNA-seq across three distinct AKI models (I/R-AKI, cisplatin-induced AKI, and sepsis-AKI) compared with sham controls ( n = 3–4 per group). (E) The schematic illustration showed the circularization of AASS exons 2–11 to form circAASS . The back-splicing junction of circAASS was verified by RT-PCR and Sanger sequencing. (F) CircAASS expression in TECs was detected by RT-PCR. Agarose gel electrophoresis showed that divergent primers amplified circAASS in cDNA but not genomic DNA (gDNA). (G) FISH showing the expression and localization of circAASS in HK2. (H) Subcellular fractionation assay and detected by agarose gel electrophoresis. (I and J) representative images of ISH (I) and quantitative analysis (J) of circAass expression in kidney from three different mouse models of AKI. Data are presented as the mean ± sd. *** p < 0.001, by 2-tailed Student’s t test (J). Scale bars: 25 μm (G) and 200 μm (I).
Digoxin Labeled Lna Modified Circaass Probe, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/digoxin labeled lna modified circaass probe/product/Sangon Biotech
Average 86 stars, based on 1 article reviews
digoxin labeled lna modified circaass probe - by Bioz Stars, 2026-05
86/100 stars
  Buy from Supplier

90
Qiagen mircury lna mirna probe pcr assays
Upregulation of 18 miRNAs in HCC patients (A) Study design of the current study. CQ, Chongqing; BJ, Beijing. (B) Volcano plot of differentially expressed miRNAs between HCC patients and LC patients in the discovery stage. The 16 validated <t>miRNA</t> targets were annotated. (C) Unsupervised hierarchical clustering of 18 miRNA targets across 354 matched samples in validation stage 1.
Mircury Lna Mirna Probe Pcr Assays, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mircury lna mirna probe pcr assays/product/Qiagen
Average 90 stars, based on 1 article reviews
mircury lna mirna probe pcr assays - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
Telog Instruments Inc gggttagggttagggttagggttagggttagggtta (tamra) telog lna tm probe
Upregulation of 18 miRNAs in HCC patients (A) Study design of the current study. CQ, Chongqing; BJ, Beijing. (B) Volcano plot of differentially expressed miRNAs between HCC patients and LC patients in the discovery stage. The 16 validated <t>miRNA</t> targets were annotated. (C) Unsupervised hierarchical clustering of 18 miRNA targets across 354 matched samples in validation stage 1.
Gggttagggttagggttagggttagggttagggtta (Tamra) Telog Lna Tm Probe, supplied by Telog Instruments Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/gggttagggttagggttagggttagggttagggtta (tamra) telog lna tm probe/product/Telog Instruments Inc
Average 90 stars, based on 1 article reviews
gggttagggttagggttagggttagggttagggtta (tamra) telog lna tm probe - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
Qiagen tye563-teloc lna probes
Upregulation of 18 miRNAs in HCC patients (A) Study design of the current study. CQ, Chongqing; BJ, Beijing. (B) Volcano plot of differentially expressed miRNAs between HCC patients and LC patients in the discovery stage. The 16 validated <t>miRNA</t> targets were annotated. (C) Unsupervised hierarchical clustering of 18 miRNA targets across 354 matched samples in validation stage 1.
Tye563 Teloc Lna Probes, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/tye563-teloc lna probes/product/Qiagen
Average 90 stars, based on 1 article reviews
tye563-teloc lna probes - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

Image Search Results


CircAass was downregulated in renal cortex of AKI mice. (A) Cluster heat map representing distinct circRNA expression values in I/R-AKI mice compared with Sham controls. (B) Clustered heat map showing the differentially expressed circRNAs in renal cortex between the CP-AKI mice and Control mice. (C) Cluster heat map showing the differences in the expression of circRNA in SAKI mice and Sham mice. (D) Venn diagram showing the two common differentially expressed circRNAs identified by RNA-seq across three distinct AKI models (I/R-AKI, cisplatin-induced AKI, and sepsis-AKI) compared with sham controls ( n = 3–4 per group). (E) The schematic illustration showed the circularization of AASS exons 2–11 to form circAASS . The back-splicing junction of circAASS was verified by RT-PCR and Sanger sequencing. (F) CircAASS expression in TECs was detected by RT-PCR. Agarose gel electrophoresis showed that divergent primers amplified circAASS in cDNA but not genomic DNA (gDNA). (G) FISH showing the expression and localization of circAASS in HK2. (H) Subcellular fractionation assay and detected by agarose gel electrophoresis. (I and J) representative images of ISH (I) and quantitative analysis (J) of circAass expression in kidney from three different mouse models of AKI. Data are presented as the mean ± sd. *** p < 0.001, by 2-tailed Student’s t test (J). Scale bars: 25 μm (G) and 200 μm (I).

Journal: Autophagy

Article Title: CircAASS alleviates renal injury and fibrosis by regulating mitochondrial homeostasis in tubular epithelial cells

doi: 10.1080/15548627.2025.2581212

Figure Lengend Snippet: CircAass was downregulated in renal cortex of AKI mice. (A) Cluster heat map representing distinct circRNA expression values in I/R-AKI mice compared with Sham controls. (B) Clustered heat map showing the differentially expressed circRNAs in renal cortex between the CP-AKI mice and Control mice. (C) Cluster heat map showing the differences in the expression of circRNA in SAKI mice and Sham mice. (D) Venn diagram showing the two common differentially expressed circRNAs identified by RNA-seq across three distinct AKI models (I/R-AKI, cisplatin-induced AKI, and sepsis-AKI) compared with sham controls ( n = 3–4 per group). (E) The schematic illustration showed the circularization of AASS exons 2–11 to form circAASS . The back-splicing junction of circAASS was verified by RT-PCR and Sanger sequencing. (F) CircAASS expression in TECs was detected by RT-PCR. Agarose gel electrophoresis showed that divergent primers amplified circAASS in cDNA but not genomic DNA (gDNA). (G) FISH showing the expression and localization of circAASS in HK2. (H) Subcellular fractionation assay and detected by agarose gel electrophoresis. (I and J) representative images of ISH (I) and quantitative analysis (J) of circAass expression in kidney from three different mouse models of AKI. Data are presented as the mean ± sd. *** p < 0.001, by 2-tailed Student’s t test (J). Scale bars: 25 μm (G) and 200 μm (I).

Article Snippet: Sections were hybridized with digoxin-labeled LNA-modified circAASS probe (Sangon Biotech, Shanghai) at 52°C for 16 h. Following washing, sections were incubated overnight at 4°C with an anti-digoxigenin monoclonal antibody (Abcam, ab419; dilution 1:200) to facilitate detection.

Techniques: Expressing, Control, RNA Sequencing, Reverse Transcription Polymerase Chain Reaction, Sequencing, Agarose Gel Electrophoresis, Amplification, Fractionation

circAASS attenuates mitochondrial damage in injured TECs. (A and B) Knockdown of circAASS aggravates mitochondrial damage in HK2 cells, as shown by representative TEM images (A) and quantitative analysis of intact mitochondria per μm 2 (B). (C and D) Overexpression of circAASS ameliorates mitochondria in HK2 cells treated with H/R, as shown by representative TEM images (C) and quantitative analysis of intact mitochondria per μm 2 (D). (E) JC-1 staining reveals that circAASS knockdown reduces mitochondrial membrane potential in HK2 cells, both under normal and H/R-treated conditions. (F and G) Flow cytometry analysis shows that knockdown of circAASS led to reduced mitochondrial membrane potential in HK2 cells, both under normal conditions and following H/R treatment. (H) JC-1 staining reveals that circAASS overexpression elevated mitochondrial membrane potential in HK2 cells, under H/R-treated conditions. (I and J) Flow cytometry analysis shows that overexpressing circAASS leads to increased mitochondrial membrane potential in H/R-treated HK2 cells. (K) Flow cytometry analysis shows that knockdown of circAASS increased ROS levels in HK2 cells, both under normal conditions and following H/R treatment. (L) Overexpression of circAASS reduced the levels of ROS in HK2 cells, under H/R-treated conditions. Data are presented as the mean ± sd. ** p < 0.01, by 2-tailed Student’s t test (B). ** p < 0.01, *** p < 0.001, by 1-way ANOVA with Tukey’s multiple-comparison test (D, G, J, K and L). Scale bars: 2 μm (A and C, upper panel), 500 nm (A and C, lower panel) and 100 μm (E and H).

Journal: Autophagy

Article Title: CircAASS alleviates renal injury and fibrosis by regulating mitochondrial homeostasis in tubular epithelial cells

doi: 10.1080/15548627.2025.2581212

Figure Lengend Snippet: circAASS attenuates mitochondrial damage in injured TECs. (A and B) Knockdown of circAASS aggravates mitochondrial damage in HK2 cells, as shown by representative TEM images (A) and quantitative analysis of intact mitochondria per μm 2 (B). (C and D) Overexpression of circAASS ameliorates mitochondria in HK2 cells treated with H/R, as shown by representative TEM images (C) and quantitative analysis of intact mitochondria per μm 2 (D). (E) JC-1 staining reveals that circAASS knockdown reduces mitochondrial membrane potential in HK2 cells, both under normal and H/R-treated conditions. (F and G) Flow cytometry analysis shows that knockdown of circAASS led to reduced mitochondrial membrane potential in HK2 cells, both under normal conditions and following H/R treatment. (H) JC-1 staining reveals that circAASS overexpression elevated mitochondrial membrane potential in HK2 cells, under H/R-treated conditions. (I and J) Flow cytometry analysis shows that overexpressing circAASS leads to increased mitochondrial membrane potential in H/R-treated HK2 cells. (K) Flow cytometry analysis shows that knockdown of circAASS increased ROS levels in HK2 cells, both under normal conditions and following H/R treatment. (L) Overexpression of circAASS reduced the levels of ROS in HK2 cells, under H/R-treated conditions. Data are presented as the mean ± sd. ** p < 0.01, by 2-tailed Student’s t test (B). ** p < 0.01, *** p < 0.001, by 1-way ANOVA with Tukey’s multiple-comparison test (D, G, J, K and L). Scale bars: 2 μm (A and C, upper panel), 500 nm (A and C, lower panel) and 100 μm (E and H).

Article Snippet: Sections were hybridized with digoxin-labeled LNA-modified circAASS probe (Sangon Biotech, Shanghai) at 52°C for 16 h. Following washing, sections were incubated overnight at 4°C with an anti-digoxigenin monoclonal antibody (Abcam, ab419; dilution 1:200) to facilitate detection.

Techniques: Knockdown, Over Expression, Staining, Membrane, Flow Cytometry, Comparison

circAASS inhibits apoptosis and pro-fibrotic responses in injured TECs. (A and B) The effects of circAASS knockdown on apoptosis and the quantification data. Cell apoptosis of HK2 was assayed by co-staining of ANXA5/annexin V and propidium iodide followed by flow cytometric analysis. (C and D) The effects of circAASS overexpression on apoptosis and the quantification data. (E) qPCR showing the expression of pro-inflammatory cytokines in HK2 cells transfected with circAASS siRNA. (F) qPCR showing the expression of pro-inflammatory cytokines in HK2 cells overexpressed with circAASS . (G) Diagram shows the experimental design. (H) Western blotting showing protein levels of FN1, COL1A, and ACTA2/αSMA in NRK49F cells incubated with conditional medium from HK2 cells with or without circAASS -KD treatment. (I) Western blotting showing protein levels of FN1, COL1A, and ACTA2/αSMA in NRK49F cells incubated with the supernatant from H/R-treated HK2 cells overexpressed with circAASS or empty vector. Data are presented as the mean ± sd. * p < 0.05, ** p < 0.01, *** p < 0.001, by 1-way ANOVA with Tukey’s multiple-comparison test (B, D, E and F).

Journal: Autophagy

Article Title: CircAASS alleviates renal injury and fibrosis by regulating mitochondrial homeostasis in tubular epithelial cells

doi: 10.1080/15548627.2025.2581212

Figure Lengend Snippet: circAASS inhibits apoptosis and pro-fibrotic responses in injured TECs. (A and B) The effects of circAASS knockdown on apoptosis and the quantification data. Cell apoptosis of HK2 was assayed by co-staining of ANXA5/annexin V and propidium iodide followed by flow cytometric analysis. (C and D) The effects of circAASS overexpression on apoptosis and the quantification data. (E) qPCR showing the expression of pro-inflammatory cytokines in HK2 cells transfected with circAASS siRNA. (F) qPCR showing the expression of pro-inflammatory cytokines in HK2 cells overexpressed with circAASS . (G) Diagram shows the experimental design. (H) Western blotting showing protein levels of FN1, COL1A, and ACTA2/αSMA in NRK49F cells incubated with conditional medium from HK2 cells with or without circAASS -KD treatment. (I) Western blotting showing protein levels of FN1, COL1A, and ACTA2/αSMA in NRK49F cells incubated with the supernatant from H/R-treated HK2 cells overexpressed with circAASS or empty vector. Data are presented as the mean ± sd. * p < 0.05, ** p < 0.01, *** p < 0.001, by 1-way ANOVA with Tukey’s multiple-comparison test (B, D, E and F).

Article Snippet: Sections were hybridized with digoxin-labeled LNA-modified circAASS probe (Sangon Biotech, Shanghai) at 52°C for 16 h. Following washing, sections were incubated overnight at 4°C with an anti-digoxigenin monoclonal antibody (Abcam, ab419; dilution 1:200) to facilitate detection.

Techniques: Knockdown, Staining, Over Expression, Expressing, Transfection, Western Blot, Incubation, Plasmid Preparation, Comparison

Cytoplasmic circAASS modulates MIR324-3p /PINK1 axis-regulated mitophagy in TECs. (A) RIP assay confirms the interaction between circAASS and AGO2. (B) qPCR analysis showing the expression of PINK1 in circAASS -overexpressing HK2 cells. (C) Western blotting showing the protein expression of PINK1, SQSTM1/p62 and LC3 in circAASS -overexpressing HK2 cells exposed to H/R treatment. (D and E) mKeima expression in HK2 cells transfected with circAASS or empty vector, with or without H/R treatment. Live-cell confocal imaging was performed (excitation 561 nm: red; excitation 488 nm: green). The 561/488 nm excitation ratio of mKeima was quantified; n = 3. (F) Integrative analysis of bioinformatics prediction to screen for circAASS -binding miRNAs, MIR324-3p and MIR345-5p are the candidate miRNAs that also target 3‘ UTR of PINK1 . (G and H) Luciferase reporter assays showing MIR324-3p mimics, but not MIR345-5p mimics, remarkably inhibited luciferase activity of PINK1 -3‘ UTR or circAASS , as compared to NC mimics. (I and J) Luciferase reporter assays showing mutant circAASS or mutant PINK1 -3’ UTR reversed the effects of MIR324-3p mimics on luciferase activity of PINK1 -3‘UTR or circAASS . (K) RIP assay showing that circAASS directly bound to MIR324-3p in HK2 cells. (L) RNA FISH showing the colocalization of circAASS and MIR324-3p in the cytoplasm of HK2 cells. (M-S) Western blot and quantification data showing the expression of mitophagy related factors in circAASS -overexpressed HK2 cells transfected with NC mimic or MIR324-3p . (T) qPCR analysis of pro-inflammatory gene expression ( TNF , IL1B , CCL2 ) in HK2 cells. PINK1 knockdown markedly exacerbated the inflammatory response induced by H/R and abolished the anti-inflammatory effect of circAASS overexpression. Data are presented as the mean ± sd. *** p < 0.001, by 2-tailed Student’s t test (A, B and K). *** p < 0.001, by 1-way ANOVA with Tukey’s multiple-comparison test (E, G, H, I, J, N, O, P, Q, R, S, and T). Scale bars: 25 μm (D) and 10 μm (l).

Journal: Autophagy

Article Title: CircAASS alleviates renal injury and fibrosis by regulating mitochondrial homeostasis in tubular epithelial cells

doi: 10.1080/15548627.2025.2581212

Figure Lengend Snippet: Cytoplasmic circAASS modulates MIR324-3p /PINK1 axis-regulated mitophagy in TECs. (A) RIP assay confirms the interaction between circAASS and AGO2. (B) qPCR analysis showing the expression of PINK1 in circAASS -overexpressing HK2 cells. (C) Western blotting showing the protein expression of PINK1, SQSTM1/p62 and LC3 in circAASS -overexpressing HK2 cells exposed to H/R treatment. (D and E) mKeima expression in HK2 cells transfected with circAASS or empty vector, with or without H/R treatment. Live-cell confocal imaging was performed (excitation 561 nm: red; excitation 488 nm: green). The 561/488 nm excitation ratio of mKeima was quantified; n = 3. (F) Integrative analysis of bioinformatics prediction to screen for circAASS -binding miRNAs, MIR324-3p and MIR345-5p are the candidate miRNAs that also target 3‘ UTR of PINK1 . (G and H) Luciferase reporter assays showing MIR324-3p mimics, but not MIR345-5p mimics, remarkably inhibited luciferase activity of PINK1 -3‘ UTR or circAASS , as compared to NC mimics. (I and J) Luciferase reporter assays showing mutant circAASS or mutant PINK1 -3’ UTR reversed the effects of MIR324-3p mimics on luciferase activity of PINK1 -3‘UTR or circAASS . (K) RIP assay showing that circAASS directly bound to MIR324-3p in HK2 cells. (L) RNA FISH showing the colocalization of circAASS and MIR324-3p in the cytoplasm of HK2 cells. (M-S) Western blot and quantification data showing the expression of mitophagy related factors in circAASS -overexpressed HK2 cells transfected with NC mimic or MIR324-3p . (T) qPCR analysis of pro-inflammatory gene expression ( TNF , IL1B , CCL2 ) in HK2 cells. PINK1 knockdown markedly exacerbated the inflammatory response induced by H/R and abolished the anti-inflammatory effect of circAASS overexpression. Data are presented as the mean ± sd. *** p < 0.001, by 2-tailed Student’s t test (A, B and K). *** p < 0.001, by 1-way ANOVA with Tukey’s multiple-comparison test (E, G, H, I, J, N, O, P, Q, R, S, and T). Scale bars: 25 μm (D) and 10 μm (l).

Article Snippet: Sections were hybridized with digoxin-labeled LNA-modified circAASS probe (Sangon Biotech, Shanghai) at 52°C for 16 h. Following washing, sections were incubated overnight at 4°C with an anti-digoxigenin monoclonal antibody (Abcam, ab419; dilution 1:200) to facilitate detection.

Techniques: Expressing, Western Blot, Transfection, Plasmid Preparation, Imaging, Binding Assay, Luciferase, Activity Assay, Mutagenesis, Gene Expression, Knockdown, Over Expression, Comparison

circAASS inhibits ubiquitination-proteasome pathways mediated PPARGC1A/PGC-1α degradation by directly binding with PPARGC1A/PGC-1α. (A) PPARGC1A/PGC-1α levels in affinity-isolation assays using biotinylated antisense probes (control) or probes targeting the junction site sequence of circAASS . (B) Analysis for circAASS enrichment by PPARGC1A/PGC-1α, as revealed by RNA immunoprecipitation assay. (C) Schematic of circAASS linearization. (D) The schematic of rna affinity-isolation assay with streptavidin magnetic beads (SA beads) to enriched the proteins interacted with biotinylated RL circAASS or L circAASS -JS. (E) RNA affinity-isolation assays showing the interaction of L circAASS -JS with PPARGC1A/PGC-1α. (F) RNA affinity-isolation assays showing the interaction of L circAASS -JS with PPARGC1A/PGC-1α, as compared to L circAASS -JS mut . (G) The schematic showing sequential truncated mutations of L circAASS -JS and the 518–776 nt of L circAASS -JS contained the junction sequence. (H) RNA affinity-isolation assay using sequentially truncated L circAASS -JS mutants reveals that both full-length L circAASS -JS and a truncated fragment (518–776 nt) bind to PPARGC1A/PGC-1α. (I) To test the binding site of PPARGC1A/PGC-1α and circAASS , truncated mutants of PPARGC1A/PGC-1α were established and tagged with Flag. (J) L circAASS -JS interacts with PPARGC1A/PGC-1α, as shown by RNA affinity-isolation assay detecting binding to both the full-length protein and domain 3. (K and L) Western blotting and quantification data reveal that the promoting role of circAASS on PPARGC1A/PGC-1α expression is abrogated by using the proteasome inhibitor (MG132). (M) HA-Ub-expressing HK2 cells were transfected with circAASS , L circAASS -JS, RL circAASS , L circAASS -JS mut or L circAASS -JS (518–776) to test their role on the ubiquitination of PPARGC1A/PGC-1α. (N) Co-IP assay demonstrates increased interaction between RNF34 and PPARGC1A/PGC-1α upon circAASS knockdown in HK2 cells. (O) Co-IP assay shows decreased interaction between RNF34 and PPARGC1A/PGC-1α upon circAASS overexpression in H/R-treated HK2 cells. (P) Co-IP assay reveals RNF34-PPARGC1A/PGC-1α interaction in H/R-treated HK2 cells overexpressing circAASS variants (L circAASS -JS, RL circAASS , L circAASS -JS mut , or L circAASS -JS 518–776). (Q) Western blot analysis demonstrates that RNF34 knockdown abolishes circAASS knockdown-induced PPARGC1A/PGC-1α ubiquitination. Data are presented as the mean ± sd. ** p < 0.01, *** p < 0.001, by 1-way ANOVA with Tukey’s multiple-comparison test (L).

Journal: Autophagy

Article Title: CircAASS alleviates renal injury and fibrosis by regulating mitochondrial homeostasis in tubular epithelial cells

doi: 10.1080/15548627.2025.2581212

Figure Lengend Snippet: circAASS inhibits ubiquitination-proteasome pathways mediated PPARGC1A/PGC-1α degradation by directly binding with PPARGC1A/PGC-1α. (A) PPARGC1A/PGC-1α levels in affinity-isolation assays using biotinylated antisense probes (control) or probes targeting the junction site sequence of circAASS . (B) Analysis for circAASS enrichment by PPARGC1A/PGC-1α, as revealed by RNA immunoprecipitation assay. (C) Schematic of circAASS linearization. (D) The schematic of rna affinity-isolation assay with streptavidin magnetic beads (SA beads) to enriched the proteins interacted with biotinylated RL circAASS or L circAASS -JS. (E) RNA affinity-isolation assays showing the interaction of L circAASS -JS with PPARGC1A/PGC-1α. (F) RNA affinity-isolation assays showing the interaction of L circAASS -JS with PPARGC1A/PGC-1α, as compared to L circAASS -JS mut . (G) The schematic showing sequential truncated mutations of L circAASS -JS and the 518–776 nt of L circAASS -JS contained the junction sequence. (H) RNA affinity-isolation assay using sequentially truncated L circAASS -JS mutants reveals that both full-length L circAASS -JS and a truncated fragment (518–776 nt) bind to PPARGC1A/PGC-1α. (I) To test the binding site of PPARGC1A/PGC-1α and circAASS , truncated mutants of PPARGC1A/PGC-1α were established and tagged with Flag. (J) L circAASS -JS interacts with PPARGC1A/PGC-1α, as shown by RNA affinity-isolation assay detecting binding to both the full-length protein and domain 3. (K and L) Western blotting and quantification data reveal that the promoting role of circAASS on PPARGC1A/PGC-1α expression is abrogated by using the proteasome inhibitor (MG132). (M) HA-Ub-expressing HK2 cells were transfected with circAASS , L circAASS -JS, RL circAASS , L circAASS -JS mut or L circAASS -JS (518–776) to test their role on the ubiquitination of PPARGC1A/PGC-1α. (N) Co-IP assay demonstrates increased interaction between RNF34 and PPARGC1A/PGC-1α upon circAASS knockdown in HK2 cells. (O) Co-IP assay shows decreased interaction between RNF34 and PPARGC1A/PGC-1α upon circAASS overexpression in H/R-treated HK2 cells. (P) Co-IP assay reveals RNF34-PPARGC1A/PGC-1α interaction in H/R-treated HK2 cells overexpressing circAASS variants (L circAASS -JS, RL circAASS , L circAASS -JS mut , or L circAASS -JS 518–776). (Q) Western blot analysis demonstrates that RNF34 knockdown abolishes circAASS knockdown-induced PPARGC1A/PGC-1α ubiquitination. Data are presented as the mean ± sd. ** p < 0.01, *** p < 0.001, by 1-way ANOVA with Tukey’s multiple-comparison test (L).

Article Snippet: Sections were hybridized with digoxin-labeled LNA-modified circAASS probe (Sangon Biotech, Shanghai) at 52°C for 16 h. Following washing, sections were incubated overnight at 4°C with an anti-digoxigenin monoclonal antibody (Abcam, ab419; dilution 1:200) to facilitate detection.

Techniques: Ubiquitin Proteomics, Binding Assay, Isolation, Control, Sequencing, RNA Immunoprecipitation, Magnetic Beads, Western Blot, Expressing, Transfection, Co-Immunoprecipitation Assay, Knockdown, Over Expression, Comparison

IGF2BP2 functions as a negative regulator of circAASS circularization in TECs. (A and B) IGF2BP2 protein expression in kidney tissues from IRI-AKI mice by western blot (A) and quantification analysis (B). (C and D) IGF2BP2 expression in CP-AKI mouse kidney tissues (C, western blot; D, quantification). (E and F) Detection of IGF2BP2 in SAKI mouse kidneys (E, representative blot; F, quantitative data). (G and H) Western blotting showing IGF2BP2 expression in H/R-, cisplatin- or LPS-treated primary TECs, and the quantification data. (I) The primer sets designed in the pre-mRNA of Aass . (J) The transcript abundance of amplicons a-f relative to input, detected by rna immunoprecipitation with anti-IGF2BP2 in lysates from primary TECs, followed by qPCR assay. (K-M) The relative levels of circAass in primary TECs with Igf2bp2 knockdown upon H/R (K), cisplatin (L), and LPS (M) treatment. (N) The relative levels of circAass , Aass mRNA and Aass pre-mRNA in primary TECs transfected with Igf2bp2 overexpression plasmids. Data are presented as the mean ± sd. *** p < 0.001, by 2-tailed Student’s t test (B, D, F, J, K, L and M). *** p < 0.001, by 1-way ANOVA with Tukey’s multiple-comparison test (H and N).

Journal: Autophagy

Article Title: CircAASS alleviates renal injury and fibrosis by regulating mitochondrial homeostasis in tubular epithelial cells

doi: 10.1080/15548627.2025.2581212

Figure Lengend Snippet: IGF2BP2 functions as a negative regulator of circAASS circularization in TECs. (A and B) IGF2BP2 protein expression in kidney tissues from IRI-AKI mice by western blot (A) and quantification analysis (B). (C and D) IGF2BP2 expression in CP-AKI mouse kidney tissues (C, western blot; D, quantification). (E and F) Detection of IGF2BP2 in SAKI mouse kidneys (E, representative blot; F, quantitative data). (G and H) Western blotting showing IGF2BP2 expression in H/R-, cisplatin- or LPS-treated primary TECs, and the quantification data. (I) The primer sets designed in the pre-mRNA of Aass . (J) The transcript abundance of amplicons a-f relative to input, detected by rna immunoprecipitation with anti-IGF2BP2 in lysates from primary TECs, followed by qPCR assay. (K-M) The relative levels of circAass in primary TECs with Igf2bp2 knockdown upon H/R (K), cisplatin (L), and LPS (M) treatment. (N) The relative levels of circAass , Aass mRNA and Aass pre-mRNA in primary TECs transfected with Igf2bp2 overexpression plasmids. Data are presented as the mean ± sd. *** p < 0.001, by 2-tailed Student’s t test (B, D, F, J, K, L and M). *** p < 0.001, by 1-way ANOVA with Tukey’s multiple-comparison test (H and N).

Article Snippet: Sections were hybridized with digoxin-labeled LNA-modified circAASS probe (Sangon Biotech, Shanghai) at 52°C for 16 h. Following washing, sections were incubated overnight at 4°C with an anti-digoxigenin monoclonal antibody (Abcam, ab419; dilution 1:200) to facilitate detection.

Techniques: Expressing, Western Blot, RNA Immunoprecipitation, Knockdown, Transfection, Over Expression, Comparison

circAass alleviates acute kidney injury, renal inflammation by improving mitochondrial homeostasis in TECs. (A) Diagram shows the experimental design. (B) Representative images of luminescent imaging for kidney, heart, liver, lung and spleen from mice treated with AAV9-luciferase- circAass through the tail vein. (C and D) Representative images and quantification data of ISH of circAass expression in kidneys from mice injected with AAV9- circAass . (E) Serum creatinine level in I/R-AKI mice injected with either AAV9-Vector or AAV9- circAass 2 days post I/R treatment. (F and G) Representative images and quantification data of PAS staining kidney tissue from mice treated with AAV9- circAass 2 days post I/R treatment. (H and I) Representative images and quantification data of IHC staining of HAVCR1/KIM-1 in kidney tissue from mice treated with AAV9- circAass , at 2 days post injury. (J) Representative images of DHE staining. DHE nuclear staining indicates the presence of ROS. (K) Representative TEM images showing mitochondrial morphology in TECs from different experimental groups of mice. Higher-magnification insets highlight detailed ultrastructural features of mitochondria, including cristae organization and membrane integrity. (L and M) Western Blotting and quantification data showing the expression levels of PINK1 and other mitophagy-related proteins in kidney cortex. (N and O) Western blotting and quantification data showing the expression levels of mitochondrial biogenesis related proteins in kidney cortex. (P and Q) Representative images and quantification data of IHC staining of ADGRE1/F4/80 in kidney tissue from mice treated with AAV9- circAass , at 2 days post injury. (R) qPCR results showing the expression levels of Tnf , Il1b and Ccl2 in the kidney cortex. (S and T) Representative images and quantification data of TUNEL staining showed that ectopic expression of circAass inhibited TEC apoptosis of AKI mice. Data are presented as the mean ± sd. ** p < 0. 01, *** p < 0.001, by 1-way ANOVA with Tukey’s multiple-comparison test (D, E, G, L, M, O and R). *** p < 0.001, by 2-tailed Student’s t test (Q and T). Scale bars: 100 μm (C, F, H and P), 50 μm (J and S), 1 μm (K, upper panel) and 500 nm (K, lower panel).

Journal: Autophagy

Article Title: CircAASS alleviates renal injury and fibrosis by regulating mitochondrial homeostasis in tubular epithelial cells

doi: 10.1080/15548627.2025.2581212

Figure Lengend Snippet: circAass alleviates acute kidney injury, renal inflammation by improving mitochondrial homeostasis in TECs. (A) Diagram shows the experimental design. (B) Representative images of luminescent imaging for kidney, heart, liver, lung and spleen from mice treated with AAV9-luciferase- circAass through the tail vein. (C and D) Representative images and quantification data of ISH of circAass expression in kidneys from mice injected with AAV9- circAass . (E) Serum creatinine level in I/R-AKI mice injected with either AAV9-Vector or AAV9- circAass 2 days post I/R treatment. (F and G) Representative images and quantification data of PAS staining kidney tissue from mice treated with AAV9- circAass 2 days post I/R treatment. (H and I) Representative images and quantification data of IHC staining of HAVCR1/KIM-1 in kidney tissue from mice treated with AAV9- circAass , at 2 days post injury. (J) Representative images of DHE staining. DHE nuclear staining indicates the presence of ROS. (K) Representative TEM images showing mitochondrial morphology in TECs from different experimental groups of mice. Higher-magnification insets highlight detailed ultrastructural features of mitochondria, including cristae organization and membrane integrity. (L and M) Western Blotting and quantification data showing the expression levels of PINK1 and other mitophagy-related proteins in kidney cortex. (N and O) Western blotting and quantification data showing the expression levels of mitochondrial biogenesis related proteins in kidney cortex. (P and Q) Representative images and quantification data of IHC staining of ADGRE1/F4/80 in kidney tissue from mice treated with AAV9- circAass , at 2 days post injury. (R) qPCR results showing the expression levels of Tnf , Il1b and Ccl2 in the kidney cortex. (S and T) Representative images and quantification data of TUNEL staining showed that ectopic expression of circAass inhibited TEC apoptosis of AKI mice. Data are presented as the mean ± sd. ** p < 0. 01, *** p < 0.001, by 1-way ANOVA with Tukey’s multiple-comparison test (D, E, G, L, M, O and R). *** p < 0.001, by 2-tailed Student’s t test (Q and T). Scale bars: 100 μm (C, F, H and P), 50 μm (J and S), 1 μm (K, upper panel) and 500 nm (K, lower panel).

Article Snippet: Sections were hybridized with digoxin-labeled LNA-modified circAASS probe (Sangon Biotech, Shanghai) at 52°C for 16 h. Following washing, sections were incubated overnight at 4°C with an anti-digoxigenin monoclonal antibody (Abcam, ab419; dilution 1:200) to facilitate detection.

Techniques: Imaging, Luciferase, Expressing, Injection, Plasmid Preparation, Staining, Immunohistochemistry, Membrane, Western Blot, TUNEL Assay, Comparison

Ectopic expression of circAass inhibits tubulointerstitial fibrosis post I/R- or CP-induced AKI. (A) Diagram shows the experimental design. (B) Representative images of ISH of circAass expression in kidneys from mice treated with AAV9-Vector or AAV9- circAass 3 weeks post-I/R treatment. (C) DHE staining shows that overexpression of circAass decreased the levels of ROS 3 weeks post-I/R treatment. (D) Western blotting shows that overexpression of circAass decreased the expression of PPARGC1A/PGC-1α and other mitochondrial biogenesis-associated molecules 3 weeks post-I/R treatment. (E) Western blotting shows that overexpression of circAass decreased the expression of PINK1 and other mitophagy-associated molecules 3 weeks post-I/R treatment. (F and G) Representative images and quantification data of IHC staining of ADGRE1/F4/80 in kidney tissue from I/R mice treated with AAV9-Vector or AAV9- circAass 3 weeks post-I/R treatment. (H and I) Representative images and quantification data of Masson’s trichrome staining in I/R mice injected with either AAV9-Vector or AAV9- circAass 3 weeks post-I/R treatment. (J) Western blot shows that overexpression of circAass decreased the expression of profibrotic factors 3 weeks post-I/R treatment. (K-M) Representative images and quantification data of IHC staining in I/R mice injected with either AAV9-Vector or AAV9- circAass 3 weeks post-I/R treatment. (N) Serum creatinine level in I/R-AKI mice injected with either AAV9-Vector or AAV9- circAass 3 weeks post I/R treatment. Data are presented as the mean ± sd. ** p < 0. 01, *** p < 0.001, by 1-way ANOVA with Tukey’s multiple-comparison test (G, I, L, M and N). Scale bars: 100 μm (B and F), 50 μm (C), 200 μm (H and K).

Journal: Autophagy

Article Title: CircAASS alleviates renal injury and fibrosis by regulating mitochondrial homeostasis in tubular epithelial cells

doi: 10.1080/15548627.2025.2581212

Figure Lengend Snippet: Ectopic expression of circAass inhibits tubulointerstitial fibrosis post I/R- or CP-induced AKI. (A) Diagram shows the experimental design. (B) Representative images of ISH of circAass expression in kidneys from mice treated with AAV9-Vector or AAV9- circAass 3 weeks post-I/R treatment. (C) DHE staining shows that overexpression of circAass decreased the levels of ROS 3 weeks post-I/R treatment. (D) Western blotting shows that overexpression of circAass decreased the expression of PPARGC1A/PGC-1α and other mitochondrial biogenesis-associated molecules 3 weeks post-I/R treatment. (E) Western blotting shows that overexpression of circAass decreased the expression of PINK1 and other mitophagy-associated molecules 3 weeks post-I/R treatment. (F and G) Representative images and quantification data of IHC staining of ADGRE1/F4/80 in kidney tissue from I/R mice treated with AAV9-Vector or AAV9- circAass 3 weeks post-I/R treatment. (H and I) Representative images and quantification data of Masson’s trichrome staining in I/R mice injected with either AAV9-Vector or AAV9- circAass 3 weeks post-I/R treatment. (J) Western blot shows that overexpression of circAass decreased the expression of profibrotic factors 3 weeks post-I/R treatment. (K-M) Representative images and quantification data of IHC staining in I/R mice injected with either AAV9-Vector or AAV9- circAass 3 weeks post-I/R treatment. (N) Serum creatinine level in I/R-AKI mice injected with either AAV9-Vector or AAV9- circAass 3 weeks post I/R treatment. Data are presented as the mean ± sd. ** p < 0. 01, *** p < 0.001, by 1-way ANOVA with Tukey’s multiple-comparison test (G, I, L, M and N). Scale bars: 100 μm (B and F), 50 μm (C), 200 μm (H and K).

Article Snippet: Sections were hybridized with digoxin-labeled LNA-modified circAASS probe (Sangon Biotech, Shanghai) at 52°C for 16 h. Following washing, sections were incubated overnight at 4°C with an anti-digoxigenin monoclonal antibody (Abcam, ab419; dilution 1:200) to facilitate detection.

Techniques: Expressing, Plasmid Preparation, Staining, Over Expression, Western Blot, Immunohistochemistry, Injection, Comparison

Downregulation of circAASS associates with mitochondrial dyshomeostasis in patients with AKI and CKD. (A-E) Representative images of kidney sections staining with PAS staining, ISH for circAASS , IHC staining for PPARGC1A/PGC-1α or PINK1, DHE staining in renal biopsy samples from patients with AKI (A), and quantification data (B-E). (F-I) Pearson correlation analyses for association between intrarenal circAASS with PPARGC1A/PGC-1α expression score (F) or PINK1 expression score (G) or DHE staining score (H) or acute tubular injury score (I). (J-N) Representative images of kidneys with Masson staining, ISH for circAASS , IHC staining for PPARGC1A/PGC-1α or PINK1, DHE staining in renal biopsy samples from patients with renal fibrosis (J), and quantification data (K-N). (O-R) Pearson correlation analyses for association between intrarenal circAASS with PPARGC1A/PGC-1α expression score (O) or PINK1 expression score (P) or DHE staining score (Q) or tubular interstitial fibrosis index (R). Data are presented as the mean ± sd. ** p < 0. 01, *** p < 0.001, by 2-tailed Student’s t test (B, C, D, E, K, L, M and N). Scale bars: 100 μm (A and J).

Journal: Autophagy

Article Title: CircAASS alleviates renal injury and fibrosis by regulating mitochondrial homeostasis in tubular epithelial cells

doi: 10.1080/15548627.2025.2581212

Figure Lengend Snippet: Downregulation of circAASS associates with mitochondrial dyshomeostasis in patients with AKI and CKD. (A-E) Representative images of kidney sections staining with PAS staining, ISH for circAASS , IHC staining for PPARGC1A/PGC-1α or PINK1, DHE staining in renal biopsy samples from patients with AKI (A), and quantification data (B-E). (F-I) Pearson correlation analyses for association between intrarenal circAASS with PPARGC1A/PGC-1α expression score (F) or PINK1 expression score (G) or DHE staining score (H) or acute tubular injury score (I). (J-N) Representative images of kidneys with Masson staining, ISH for circAASS , IHC staining for PPARGC1A/PGC-1α or PINK1, DHE staining in renal biopsy samples from patients with renal fibrosis (J), and quantification data (K-N). (O-R) Pearson correlation analyses for association between intrarenal circAASS with PPARGC1A/PGC-1α expression score (O) or PINK1 expression score (P) or DHE staining score (Q) or tubular interstitial fibrosis index (R). Data are presented as the mean ± sd. ** p < 0. 01, *** p < 0.001, by 2-tailed Student’s t test (B, C, D, E, K, L, M and N). Scale bars: 100 μm (A and J).

Article Snippet: Sections were hybridized with digoxin-labeled LNA-modified circAASS probe (Sangon Biotech, Shanghai) at 52°C for 16 h. Following washing, sections were incubated overnight at 4°C with an anti-digoxigenin monoclonal antibody (Abcam, ab419; dilution 1:200) to facilitate detection.

Techniques: Staining, Immunohistochemistry, Expressing

Schematic illustration of the mechanism whereby circAASS regulates mitochondrial homeostasis in kidney injury and renal fibrosis. Under normal conditions, cytoplasm-localized circAASS acts as a ceRNA by sequestering MIR324-3p , thus maintaining the expression of PINK1 and promoting mitophagy; nucleus-localized circAASS directly interact with the PPARGC1A/PGC-1α protein, inhibiting its ubiquitin-mediated degradation and thereby facilitating post-translational modifications that promote mitochondrial biogenesis. Under Aki conditions, low-expression of circAASS inhibits mitophagy and mitochondrial biogenesis, thereby causing pro-fibrotic and pro-inflammatory effects of TECs.

Journal: Autophagy

Article Title: CircAASS alleviates renal injury and fibrosis by regulating mitochondrial homeostasis in tubular epithelial cells

doi: 10.1080/15548627.2025.2581212

Figure Lengend Snippet: Schematic illustration of the mechanism whereby circAASS regulates mitochondrial homeostasis in kidney injury and renal fibrosis. Under normal conditions, cytoplasm-localized circAASS acts as a ceRNA by sequestering MIR324-3p , thus maintaining the expression of PINK1 and promoting mitophagy; nucleus-localized circAASS directly interact with the PPARGC1A/PGC-1α protein, inhibiting its ubiquitin-mediated degradation and thereby facilitating post-translational modifications that promote mitochondrial biogenesis. Under Aki conditions, low-expression of circAASS inhibits mitophagy and mitochondrial biogenesis, thereby causing pro-fibrotic and pro-inflammatory effects of TECs.

Article Snippet: Sections were hybridized with digoxin-labeled LNA-modified circAASS probe (Sangon Biotech, Shanghai) at 52°C for 16 h. Following washing, sections were incubated overnight at 4°C with an anti-digoxigenin monoclonal antibody (Abcam, ab419; dilution 1:200) to facilitate detection.

Techniques: Expressing, Ubiquitin Proteomics

Upregulation of 18 miRNAs in HCC patients (A) Study design of the current study. CQ, Chongqing; BJ, Beijing. (B) Volcano plot of differentially expressed miRNAs between HCC patients and LC patients in the discovery stage. The 16 validated miRNA targets were annotated. (C) Unsupervised hierarchical clustering of 18 miRNA targets across 354 matched samples in validation stage 1.

Journal: iScience

Article Title: Establishing a miRNA panel for hepatocellular carcinoma screening through a multicenter study

doi: 10.1016/j.isci.2025.112986

Figure Lengend Snippet: Upregulation of 18 miRNAs in HCC patients (A) Study design of the current study. CQ, Chongqing; BJ, Beijing. (B) Volcano plot of differentially expressed miRNAs between HCC patients and LC patients in the discovery stage. The 16 validated miRNA targets were annotated. (C) Unsupervised hierarchical clustering of 18 miRNA targets across 354 matched samples in validation stage 1.

Article Snippet: 3 μL of extracted RNA was reverse transcribed using the miRCURY LNA RT Kit (Qiagen) in 10 μL reactions. cDNA was diluted 20× before qPCR. qPCR was performed using miRCURY LNA miRNA Probe PCR Assays (Qiagen).

Techniques: Biomarker Discovery

Forest plot of study-wide significant miRNAs in HCC CI, confidence interval; SMD, standardized mean difference. Upregulation of 4 miRNAs in our findings was validated through a meta-analysis.

Journal: iScience

Article Title: Establishing a miRNA panel for hepatocellular carcinoma screening through a multicenter study

doi: 10.1016/j.isci.2025.112986

Figure Lengend Snippet: Forest plot of study-wide significant miRNAs in HCC CI, confidence interval; SMD, standardized mean difference. Upregulation of 4 miRNAs in our findings was validated through a meta-analysis.

Article Snippet: 3 μL of extracted RNA was reverse transcribed using the miRCURY LNA RT Kit (Qiagen) in 10 μL reactions. cDNA was diluted 20× before qPCR. qPCR was performed using miRCURY LNA miRNA Probe PCR Assays (Qiagen).

Techniques:

Diagnostic performance and risk score of combined panel across different sample sets (A) In the training set. (B) In the testing set. (C) In the validation set. (D) Risk score distribution of combined panel across patients with different HCC stages. The combined panel demonstrated superior diagnostic performance compared to AFP20 alone across all sample sets. miRNA panel: miR-361-5p+ miR-130a-3p+ miR-27a-3p+ miR-30d-5p+ miR-193a-5p. ∗ p < 0.05; ∗∗ p < 0.01; ∗∗∗ p < 10 − 3 ; ∗∗∗∗ p < 10 − 4 .

Journal: iScience

Article Title: Establishing a miRNA panel for hepatocellular carcinoma screening through a multicenter study

doi: 10.1016/j.isci.2025.112986

Figure Lengend Snippet: Diagnostic performance and risk score of combined panel across different sample sets (A) In the training set. (B) In the testing set. (C) In the validation set. (D) Risk score distribution of combined panel across patients with different HCC stages. The combined panel demonstrated superior diagnostic performance compared to AFP20 alone across all sample sets. miRNA panel: miR-361-5p+ miR-130a-3p+ miR-27a-3p+ miR-30d-5p+ miR-193a-5p. ∗ p < 0.05; ∗∗ p < 0.01; ∗∗∗ p < 10 − 3 ; ∗∗∗∗ p < 10 − 4 .

Article Snippet: 3 μL of extracted RNA was reverse transcribed using the miRCURY LNA RT Kit (Qiagen) in 10 μL reactions. cDNA was diluted 20× before qPCR. qPCR was performed using miRCURY LNA miRNA Probe PCR Assays (Qiagen).

Techniques: Diagnostic Assay, Biomarker Discovery

Association of miRNAs with clinical parameters (A–C) Association with (A) different HCC stages, (B) tumor size, and (C) tumor invasion. 3 miRNAs (miR-130a-3p, miR-361-5p, and miR-27a-3p) in the panel demonstrated further upregulation in patients with late-stage HCC and larger tumor size. ns, not significant; ∗P adj < 0.05; ∗∗ P adj < 0.01; ∗∗∗ P adj < 10 −3 ; ∗∗∗∗ P adj < 10 −4 . (D) Interaction network of the 5 miRNAs in the panel and their target genes. Only genes targeted by 3 or more miRNAs are shown. (E) KEGG enrichment analysis for target genes of the 5-miRNA panel.

Journal: iScience

Article Title: Establishing a miRNA panel for hepatocellular carcinoma screening through a multicenter study

doi: 10.1016/j.isci.2025.112986

Figure Lengend Snippet: Association of miRNAs with clinical parameters (A–C) Association with (A) different HCC stages, (B) tumor size, and (C) tumor invasion. 3 miRNAs (miR-130a-3p, miR-361-5p, and miR-27a-3p) in the panel demonstrated further upregulation in patients with late-stage HCC and larger tumor size. ns, not significant; ∗P adj < 0.05; ∗∗ P adj < 0.01; ∗∗∗ P adj < 10 −3 ; ∗∗∗∗ P adj < 10 −4 . (D) Interaction network of the 5 miRNAs in the panel and their target genes. Only genes targeted by 3 or more miRNAs are shown. (E) KEGG enrichment analysis for target genes of the 5-miRNA panel.

Article Snippet: 3 μL of extracted RNA was reverse transcribed using the miRCURY LNA RT Kit (Qiagen) in 10 μL reactions. cDNA was diluted 20× before qPCR. qPCR was performed using miRCURY LNA miRNA Probe PCR Assays (Qiagen).

Techniques: